>JMCP013E01 126 bp,:Filtered
GCTTGAATTCAgtgGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGgcCTTG
TGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAAAGT
TCTTTG