>JMCP013D01 141 bp,:Filtered
TGTTATTTGAAAGCTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTagcTGC
AGAGAGGCCTTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGT
ATTTAATAAAGTTCTTTGTTT