>JMCP013B01 148 bp,:Filtered
TGGAAATGTTATTTGAAAGCTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGT
AGCTGCAGAGAGGCCTTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTT
AATTGTATTTAATAAAGTTCTTTGTTTC