>JMCP013A09 144 bp,:Filtered
AATGTTATTTGAAAGCTtgaatTcAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCT
GCAGAGAGGCCTTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATT
GTATTTAATAAAGTTCTTTGTTTC