>rJMCP012H10 148 bp,:Filtered
AGCTGGGGCTGGGGTGGGCGTTGATATTGGTGTCGGGACTGGCGGCGGAGGAGGCGGCTA
GGGCTTACGATAATGCCGCGCGGGAGTTCCGCGGCGCCAAGGC