>JMCP012H04 321 bp,:Filtered
GCCAAGTCTATGaGACTCTAGtGACCGATGAGCGTGTGCTCGGATGAATCTCCCTCTCTT
CTCGAGGATTTTCCACATTGTCGTCATCTTTCCTTAGGAGCACTGTCCGGTCAGGTAGGA
CGTGAGAGGTTGgccaATTGAGGGTTCTTTCGCAAATTTCGAATAgaTCGGcaAGTGTGG
GTGTTACGTTGAGTGATCACCATGATTATGGTTTCAGTCATATGTTTTAGGTTTGAGGAA
CAAACGTAAAATTTTCGTATTGGGAGAGCCATTCCGTGCTACTAGGCCATAAGGTCATTA
GCACAATAAGATATTTATACG