>JMCP012E07 105 bp,:Filtered
ATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCCTTGTGTTTC
ATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATT