>JMCP012C04 155 bp,:Filtered
AGTCCATTGGAAATGTTATTTGAAAGCttgatttcAGTGGCAGATAGAGAGGGTTGTTCA
CACGCGTAGCTGCAGAGAGGCCTTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATG
AACGCTTAATTGTATTTAATAAAGTTCTTTGTTTC