>JMCP011H12 147 bp,:Filtered
GGAAATGTTATTTGAAAGcttGAATTCAGtGGCAGATAGAGAGGGTTGTTCACACGCGTa
gcTGcagaGAGGCCTTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTA
ATTGTATTTAATAAAGTTCTTTGTTTC