>JMCP011H09 147 bp,:Filtered
GGAAATGTTATTTGAAAGCTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTA
GCTGCAGAGAGGCCTTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTA
ATTGTATTTAATAAAGTTCTTTGTTTC