>JMCP011H08 206 bp,:Filtered
AATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATGTTATTTGAAAGCTTGAATT
CAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCCTTGTGTTTCATG
AGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAAAGTTCTTTGTTT
C