>JMCP011G10 171 bp,:Filtered
AGAGTAATTGTCAgaggctttcTTGAGTTGGAGTCCATTGGAAATGTTATTTGAAAGCTT
GAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCCTTGTGTT
TCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAAT