>JMCP011G09 189 bp,:Filtered
CGCAGAGTAATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATGTTATTTGAAAG
CTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCCTTGT
GTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAAAGTT
CTTTGTTTC