>JMCP011G04 193 bp,:Filtered
TCAACGCAGAGTAATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATGTTATTTG
AAAGCTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCC
TTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAA
AGTTCTTTGTTTC