>JMCP011G02 145 bp,:Filtered
AAATGTTATTTGAAAGCTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGC
TGCAGAGAGGCCTTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAAT
TGTATTTAATAAAGTTCTTTGTTTC