>JMCP011F06 189 bp,:Filtered
CGCAGAGTAATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATGTTATTTGAAAG
CTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCCTTGT
GTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAAAGTT
CTTTGTTTC