>JMCP011F02 197 bp,:Filtered
AATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATGTTATTTGAAAGCTTGAATT
CAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCCTTGTGTTTCATG
AGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAAAGTTCTTTGTTT
C