>JMCP011E07 118 bp,:Filtered
AGTAGTTCTGTAAGATATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAAC
ATACTATGCAAGTGTATTCATTATTAGATTTCATCAATCTATTTCTCAATTTCGTCGG
>rJMCP011E07 180 bp,
CGCCGCCGTTCCGTCTACCTCTCCGACCCCCGGCGGGCGCCGCCGCCGCcgccgCGcctA
CCAtGGCTAATACGCTGCGATTGTaTCTCACTTGcATAaggAACACTCTGGAGGCTgcca
tGTGCCTGCaGAATTTCCCTTgccaagAGGTTCTCGGGCCGAAGTGA