>JMCP011D09 138 bp,:Filtered
ATTTGAAAGCTTGAATTCagtGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAG
AGGCCTTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTT
AATAAAGTTCTTTGTTTC