>JMCP011D08 193 bp,:Filtered
TCAACGCAGAGTAATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATGTTATTTG
AAAGCTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCC
TTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAA
AGTTCTTTGTTTC