>JMCP011D04 285 bp,
TTCGGCCCGAGAACCTCTTGGCAAGGGAAATTCTGCAGGCACATGGCAGCCTCCAGAGTG
TTCCTTATGCAAGTGAGATACAATCGCAGCGTATTAGCCATGGTAGGCGCGGCGGCGGCG
GCGGCGCCCGCCGGGGGTCGGAGAGGTAGACGGAACGGCGGCGGGTGGAGGCGATCGAGC
GGCGGAGTTGAGGCGGGAT
>rJMCP011D04 280 bp,
ATCCCGCCTCAACTCCGCCGCTCGATCGCCTCCACCCGCCGCCGTTCCGTCTACCTCTCC
GACCCCCGGCGGGCGCCGCCGCCGCCGCCGCGCCTACCATGGCTAATACGCTGCGATTGT
ATCTCACTTGCATAAGGAACACTCTGGAGGCTGCCATGTGCCTGCAGAATTTCCCTTGCC
AAGAGGTTCTCGGGCCGAAGTGA