>JMCP011C11 431 bp,:Filtered:mask_remained
TATAGgTCGCGCGCTTAAgcGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTT
GTTACACACTCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCCGTTAAAGG
ATGATTGTGCGCTCGCTAcgaATCTGCCCAAGCGTAAAAGAAAAC