>JMCP011C06 286 bp,
AGAACCTCTTGGCAAGGGAAATTCTGCAGGCACATGGCAGCCTCCAGAGTGTTCCTTATG
CAAGTGAGATACAATCGCAGCGTATTAGCCATGGTAGGCGCGGCGGCGGCGGCGGCGCCC
GCCGGGGGTCGGAGAGGTAGACGGAACGGCGGCGGGTGGAGGCGATCGAGCGGCGGAGTT
GAGGCGGGAT
>rJMCP011C06 279 bp,
ATCCCGCCTCAACTCCGCCGCTCGATCGCCTCCACCCGCCGCCGTTCCGTCTACCTCTCC
GACCCCCGGCGGGCGCCGCCGCCGCCGCCGCGCCTACCATGGCTAATACGCTGCGATTGT
ATCTCACTTGCATAAGGAACACTCTGGAGGCTGCCATGTGCCTGCAGAATTTCCCTTGCC
AAGAGGTTCTCGGGCCGAAGTGA