>JMCP011C03 411 bp,:Filtered
CGCAGAGTTCATGCAGACTTACATCGGGGGAGTTTCGTGCCCATACATATGCTCCAAGAG
GCTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGTT
GAAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGGG
ATACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTGT
TGCAGCTGTTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAGTT
CTGTAAGATATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAACATACTAT
GCAAGTGTATTCATTATTAGATTTCATCAATCTATTTCTCAATTTCGTCAG