>JMCP011C02 193 bp,:Filtered
TCAACGCAGAGTAATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATGTTATTTG
AAAGCTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCC
TTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAA
AGTTCTTTGTTTC