>JMCP011C01 210 bp,:Filtered
AATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATGTTATTTGAAAGCTTGAATT
CAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCCTTGTGTTTCATG
AGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAAAGTTCTTTGTTT
C