>JMCP011B12 246 bp,:Filtered
CTAACCAGCCAGTTCCGACGATGCAGATGTATGCAAACATGGGCTGGCCAAATTCCACCG
TCAAGATGCATCATCCTTAATTCCTTCTTGCTCGACTAGTTAGATGATCTTGGCGGGGAA
AAAAAAAAAGGctAacaGgtgTatGTTcatTCAactTCTAATCTATAtattgCCTTCCCC
ATcGttactctTActCTTttgTTTTCCctagattcaccgagagcCcgagaatgGTTTTCT
TTGCGG