>JMCP011B07 189 bp,:Filtered
CGCAGAGTAATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATATTATTTGAAAG
CTTGAATTCAGTGACAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCCTTGT
GTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAAAGTT
CTTTGTTTC