>JMCP011B05 417 bp,:Filtered
TCATGCAGACTTACATCGGGGGAGTTTCGTGCCCATACATATGCTCCAAGAGGCTGGACC
ATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGTTGAAAGAAA
AACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGGGATACTACA
AGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTGTTGCAGCTG
TTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAGTTCTGTAAGA
TATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAACATACTATGCAAGTGT
ATTCATTATTAGATTTCATCAATCTATTTCTCAATTTCGTCGG