>JMCP011A07 191 bp,:Filtered
AACGCAGAGTAATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATGTTATTTGAA
AGCTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCCTT
GTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAAAG
TTCTTTGTTTC