>JMCP011A06 631 bp,
TAGGGATTTTTCAAATCCGTTGGCGGTAGTCCAGGCTTGTTGCTGACCCATAGTAGCGAA
TCCCGTTAGGGTTGGTTCTGGTTTGTTGCTGGTACTGATCAGGGTTGATGCTATTGGTTG
CTCATTATATCGGTCTGTGTGCCGAAGTTTTAGCCTATGGGGAGGAGGTGTGTATTATTG
CTTGGTAACAGGGCAGTCAATAGCACCCCGGGAGATGTTGCGGTTGTGGTTGCAGCCCGG
TCAGATTGCATTATAGTTCTGGGACGCTATGGTGCGGCTGGCGGGGAAGTGCTATGGCGC
GTGACACGAAAGATGGCTTTTCCCCTTGTTGCCCATTTACACATTTATATGATGGGCTGT
GATGCTGACATACTATACTTGATTCTCATTCATCGAGCAGGCGTGCACTCTACATACTAC
ATACTACTTGGTAGTATTTTTTATTTTTTATTCTTTATTTATTATTACTTAGCTAGTATT
TGGTCTAGCGTTAGTGCTATGCTAGCATGGGACTTGGGGCCGCGCATGTTATAGCCCCGG
GGCCTTCGTCTGTAATCTTTAGTTACTCTTTTTTAGATTAGTTAGTTGGATTTAGGCCAT
GTGGGGT