>JMCP010H11 444 bp,:Filtered
ACGCAGAGTTCATGCaGaCTtacatcgGGGGAGTTTcgtGcccATaCATATGCTCCAAGA
GGCTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGT
TGAAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGG
GATACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTG
TTGCAGCTGTTAACACCCCCACTTCagACTAGCAGGACAGGACACGTTCTGTAAAGTaGT
TCTGTAAGATATTGTTTGTTTGCaaGCGTCTCACagagaGCCACACAAAACAACATACTA
TGCAAGTGTATTcaTTATTAGATTTCATCAATCTATTTCTCAATTTCGTCAACTCTGAAA
TACAGTTCATGCAATTGTTCTGTG