>JMCP010H07 434 bp,:Filtered
CATGcagacttaCAtcgGGGGAGTTTCGTGcccaTAcatATGCTCCAAGAGGCTGGACCA
TGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGTTGAAAGAAAA
ACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGGGATACTACAA
GATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTGTTGCAGCTGT
TAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAGTTCTGTAAGAT
ATTGTTTGTTTGCAAGCGTCTCACAgagaGCCACACAAAACAACATACTATGCAAGTGTA
TTcaTTATTAGATTTCATCAATCTATTTCTCAATTTCGTCAACTCTGAAATACAGTTCAT
GCAATTGTTCTGTG