>JMCP010H05 444 bp,:Filtered
ACGCAGAGTTCATGCagactTAcatcgggGGAGTTTCGTGcccaTACAtATGCTCCAAGA
GGCTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGT
TGAAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGG
GATACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTG
TTGCAGCTGTTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAGT
TCTGTAAGATATTGTTTGTTTGCAAGCGTCTCACAgaGAGCCACACAAAACAACATACTA
TGCAAGTGTATTcaTTATTAGATTTCATCAATCTATTTCTCAATTTCGTCAACTCTGAAA
TACAGTTCATGCAATTGTTCTGTG