>JMCP010G12 395 bp,:Filtered
ATGCTCCAAGAGGCTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGC
TCCCATCCGGTTGAAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTG
GGGAGAgaAGGGATACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCAT
GGTTTCTACTGTTGCAGCTGTTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTC
TGTAAAGTAGTTCTGTAAGATATTGTTTGTTTGcAAGCGTCTCACAGagaGCCACACAAA
ACAACATACTATGCAAGTGTATTCATTATTAGATTTCATCAATCTATTTCTCAATTTCGT
CAACTCTGAAATACAGTTCATGCAATTGTTCTGTG