>JMCP010G10 395 bp,:Filtered
ATGCTCCAAGAGGCTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCagCaggCtAcGC
TCCCATCCGGTTGAAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTG
GGGAGAgaAGGGATACTACAaGATCTgcCGGGGTcgCAATATCTGTGGAGTggaCTCCAT
GGTTTCTACTGTTGCAGCTGTTAACACCCCCACTTCaGACTAGCAGGACAGGACACGTTC
TGTAAAGTaGTTCTGTAAGATATTGTTTGTTTGcaaGCGTCTCACagagaGCCACACAAA
ACAACATACTATGCAAGTGTATTcaTTATTAGATTTCATCAATCTATTTCTCAATTTCGT
CAACTCTGAAATACAGTTCATGCAATTGTTCTGTG