>JMCP010G08 443 bp,:Filtered
CGCAGAGTTCATgcagacttacatcgggGGAGTTTCGTGcccaTACATATGCTCCAAGAG
GCTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGTT
GAAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAgagaagGG
ATACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTGT
TGCAGCTGTTAACACCCCCACTTCaGACTAGCAGGACAGGACACGTTCTGTAAAGTaGTT
CTGTAAGATATTGTTTGTTTGcaAGCGTCTCACAGAgaGCCACACAAAACAACATACTAT
GCAAGTGTATTCATTATTAGATTTCATCAATCTATTTCTCAATTTCGTCAACTCTGAAAT
ACAGTTCATGCAATTGTTCTGTG