>JMCP010F07 432 bp,:Filtered
TGCAGaCTtACAtcggggGAGTTTcgtGCCcatAcatATGCTCCAAGAGGCTGGACCATG
GTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGTTGAAAGAAAAAC
CATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGaAGGGATACTACAAGA
TCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTGTTGCAGCTGTTA
ACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTaGTTCTGTAAGATAT
TGTTTGTTTGCaaGCGTCTCACAGaGAGCCACACAAAACAACATACTATGCAAGTGTATT
caTTATTAGATTTCATCAATCTATTTCTCAATTTCGTCAACTCTGAAATACAGTTCATGC
AATTGTTCTGTG