>JMCP010F06 445 bp,:Filtered
AACGCAGAGTTCATgCagacttacatcgGGgGAGTTTcgtgcccatacatATGCTCCAAG
AGGCTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGG
TTGAAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAgaag
GGATACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACT
GTTGCAGCTGTTAACACCCCCACTTCaGACTAGCAGGACAGGACACGTTCTGTAAAgtaG
TTCTGTAAGATATTGTTTGTTTGCaaGCGTCTCACagagaGCCACACAAAACAACATACT
ATGCAAGTGTATTcaTTATTAGATTTCATCAATCTATTTCTCAATTTCGTCAACTCTGAA
ATACAGTTCATGCAATTGTTCTGTG