>JMCP010F01 464 bp,:Filtered
TCATGCaGaCTTAcatcgGGGGAGTTTCGTGCCCATAcatATGCTCCAAGAGGCTGGACC
ATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGTTGAAAGAAA
AACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGGGATACTACA
AGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTGTTGCAGCTG
TTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAGTTCTGTAAGA
TATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAACATACTATGCAAGTGT
ATTCATTATTAGATTTCATCAATCTATTTCTCAATTTCGTCAACTCTGAAATACAGTTCA
TGCAATTGTTCTGTG