>JMCP010E10 659 bp,
ATTGAATACATGGCACAATGCATTTTCCGTGGCCCTCTGGTGCCAAGAACATTCAGTTCA
TATGTGACTTGTGCAATGTTGTAGCTTCCAGTAGGGACTTTGGGGGAAACTTTCTTTGGG
TAGAATCTGCGGCTTGTACAACCAGGATCGGATATATGAGTGCTGTTGTATGGTGGCTGG
GTGTCATAAATTATGAACTTAGTTCCAAGAAAATTTGACCTGAAACACATTAAAAAAGGT
TATAACGTCCTATGTGAAAATAAACTATGATTAATACCTTCAAGTAAATTGATACTCCAC
AACAAACATCTATTAAATTCAAAACCAAATAATTTTCTATCATGTCAAAATAAAATATCA
AAATCAAAGTATATATCGAGGTGGGATATAAGTTCCAAGGCAAACTGACCTTAGTTTTCC
AATATAAGTGTTACTGGACCGCGATATGTTATCTGCGTTCATCGAGATAATATATTCTGT
ATGAGTAGTCCTCCGGTTCCGCTTAGCAGAAAGAAGAAACTTTCCATTTTCTACCAGCAA
GGCTGTGAAAGTAACAAATTAACATCAGTCACTAGGAAACTCGCAGTAATGCAATGAGGA
AGTAACAAATTAAC