>JMCP010E09 658 bp,
GAGCTCGACGTTAGTGCTGATGGTCCGGCCATTGAGGCGGCCGTTCAGAGGGCTTGGGAT
GCATTTGGGCGGATCGACGCACTGATTAACAATGCCGGCGTTAGAGGTCGAGTACACACT
CCATTGGATCTAACAGAGGAAGAGTGGAATGATCTCACaaaaacaAACCTAACTGGCACA
TGGTTGGTCTCGAAATATGTTTGCTTGCGCATGTGTAACGCTAAGTTTGGAGGATCTATC
GTCAGCATCTCTTCCATTTCTGGACTTAACCGTGGGCAGTTGCCAGGAGGCCTTGCCTAT
ACTACTTCAAAGACTGCTGTTAACGCACTCACAAGGGTGATGGCACTTGAATTAGGAACA
AACAAGATAAGAGTGAACTCCATATCGCcagGGCTCTTCAAATCCGAGATAACGGATGGC
CTCATGCAGAAAGATTGGCTCAATAAGGTTGCTCTCAGGACTGTACCTTTGAGAACATTT
GGCACGTCAAATCCTGCACTGACGTCACTTGTACGTTACTTAATCCACGACTCCTCTGAA
TATATTTCTGGAAATACTTACATAGTTGACGCTGGAAATACACTGCCTGGTGTGCCTATC
TTCTCCTCTCTTTGAAACAATA