>JMCP010D12 458 bp,:Filtered
ATGGCTGGGTGCATGTCTTGTCTGGCCGaGATTAAGGCAAAGAAgtGGGGttgCCCCGTC
TGTCGTGCCAAGATTGATCAAGTGATAGGGGTATATGCTGTTTAAttgTtTCGAGAGGAA
GCAATGGAACAAGTATATGTGGAAgagCTACGATTGCGAGTTATCTTTGGTCTAAGAAGT
ATACTTTCACGGGGTAAAATTTATACTATTGCAATGTAATATCATACTAGAACTGCAGCA
AATTGTCATTCAATGTGATTGTGGTATTGTTTTTATTTTGAAGGGGAAAAAGAAAGTGAA
TATAGATAAATAAGAAAGAGAAAGGGAAGATTGTAAATTTCTTGTGTAAAGTCACTAGAC
TATCATTGTTAAAAGTGATCGTCCAATTTAAGAAAAAGGGTTTGAAATGTGCGTGGCTTA
TAAATATTTGT