>JMCP010D11 246 bp,:Filtered
GgagGCCATCTTTCGgagCCTCAATGATCTGCCACGTAGGGTCCGTGCCTTgCTGATACA
TGATGATGTGCCCTATGTGTTTTTTGATATTGATGATCCCCCCTGATTGTACTTGTACTT
TTGCTCGTTCAGATGGAAATATGGAAAAAAGGAAAAACAGAAAAAAGAGAAAGAAgaAAA
AGAAAGAAGGGAAAGTAAGCG