>JMCP010D07 611 bp,:Filtered
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAgcagcaagggatgaacgacacaagattcatggaaataggaggtatatca
atatgatgtcaacacagagaagtacgccagacATCCatacaagaatTCAAGAAACCAGTT
CAACAACAATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAA
CTACCAGAATATGGAGGAGTTCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAAT
TTTTTTTTTTTTCTACaAAGTTAaaagatgAtcatgtgACgGagtCCCAAAATCTGCAAA
TTAAACACAcgactgGgtGTTTGATTgtgTGTTAAATTATGGTTGTTTAGGGGTGAATAT
GTTGAtgatgaTTAAgcTATagattTGTTCATAGGTTATTAATTATCTCctgTCTCTATA
GTTATAttgtgtgtgAAtgaaaCcATGAAACtAtGGTTT