>JMCP010D06 592 bp,:Filtered
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTC
AACAACAATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAAC
TACCAGAATATGGAGGAGTTCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAATT
TTTTTTTTTTTctACaAAGTTAaaaaatgatcatgtgACggagtCCCAAAATctGCAAAT
TAAAcacacgactgGgtgTTTGATTgtgtgTTAAATTatGGTtgtTTAGGGgtgAataTG
TTGAtgatgattaagcTaTaaattTgtTCataGGttaTTAATTATctcctgTctctataG
tTATattgggtgtgaAtgaaaCcAtgAAAC