>rJMCP010C09 157 bp,:Filtered
TTTGGGTCAATTACATGGACTAGCGGAAAATATAAAGTTAGAAGTCCAATCGTTGTAAAT
GTTGAGTAAGGGAGTCAATCAGTTAAAGCGACAAATTGTTAGACATGTGACTAACTTGAG
GCAGACCAGTATGAAAATCAAACATGTTTTGATGTTG