>rJMCP010C07 220 bp,:Filtered
TTCATCATCCCTTGAGACAAACATATTTGGGTCAATTACATGGACTAGCGGAAAATATAA
AGTTAGAAGTCCAATCGTTGTAAATGTTGAGTAAGGGAGTCAATCAGTTAAAGCGACAAA
TTGTTAGACATGTGACTAACTTGAGGCAGACcagTATGAaAATCAAACATGTTTTGATG