>JMCP010A11 658 bp,
AATCGGTCCCTAAGGAACCCCCGAAAGGGCTGCCGTCCGATGGGTACACGAAAGTGACGA
AGTTGCTTTGACTACAGAACCATGCCTGTCTGTTGGAGCGAATTGGATGATCGGGCCGAG
GGCTGCCCCCTCTTCCCCTCACTCTCCTTTCCCTAATATGAACCTTGAGTCATCAAAGCC
TTTCTGACTCGACCTGGCCCTACGCGACTGGCGCTTCAAAAGGCGAAACTCTCGTCGTAG
TTTGGCGACCTATCTTCAGTAGGGGCCTTTAGTCTTTTGATTAGAGTAGGGGTCGCGAGA
GGGCAGAGCGTACCGCCCTGCCATAGTCACGAGTCTGTTTATAGTCGCGACTGTTGTCAT
AGTCAACAAGGTTGAAACTTCCAGGAAAAAACTTCGAATTGGGAGGGCGATCCTCCCGGT
GAACTGACCGTACCCCAAACCGACACAGGTGAACAAGTAGAGTATACTAGGGCGCTTGAG
AGAACCATGTCGAAGGAACTCGGCAAAATGACCCCGTAACTTCGGGAGAAGGGGTGCTCT
CCTATCTTTTGATTAGGAAAGCGGCACATACCAGGGGGTAGCGACTGTTTATTAAAAACA
CAGGACTCTGCTAAGTGGTAACACGATG