>JMCP010A08 542 bp,:Filtered
CCCACTtcGACAAGGCCTCTgAttgtTCAAGCCGAGTCCAGAACCAGACGGGAGGACCGg
attgCGCGCCATTCTCGTATCCGCAAGAAGGTTGAAGGGACTCCAgaAAGACCGAGattg
TCTGTATTCCGCTCTAACAAACATCTCtatGTTCAAGTCAttgATGAcACTAAAaTGCAT
ACTCTGGCAGctgTTTCAACAATgcagaAAGCCATCTcagaggAATTcAActgCAGtTCT
GGACCCACCAttgAAgtgGCAAGGAAAGTGGGTGAAGTTATAGCAAAATCCTGTCTGGAA
AAAGGGATCAGCAAGGTGGCAtttGATCGTGGTGGATACCCTTACCATGGACGTATTGAA
GCTATTGCTGATGCTGCCAGGGAAAATGGGCTTCAAttttaGAAGTTTGAgaTTTTCATT
ATTGCCATTAGTCATGTTCCTTTGATTCCTACTTCCCTGAATGAAGCAAACAGAACCATG
CAAAGAGCTATCTACTTTAAtTgCAAtTGTTGCTTCAAGG